S2-S3, Supplemental Tables12). S7). 2014;30:61420. More than 90% of SNPs were common between two high titer LHCA and SGCA samples, LHCA20/ LHCA22 and SGCA20/SGCA22 (Fig. 7(2), 1118 (2010). Over the past ten years, NGS (next generation sequencing) has been widely applied to identity pathogens, characterize genetic variants, and provide a molecular basis for building additional diagnostic tools. This allows functional sequencing libraries to be created through a second indexing PCR reaction that adds sample-specific barcodes and flow cell adapters. As a continuation of our last article, we will be covering important metrics related to long-read sequencing technologies. Next, 1 g of each library was hybridized with the SureSelect capture library. Prior to this work, obtaining a CLas whole genome sequence was a challenge. The improvement in genome coverage metrics with the tailed amplicon v2 approach was a function of improved amplicon balance (Fig. 2010;26:58995. Li Cq 26 and above). Successful grafted citrus trees were determined by HLBaspr real-time quantitative PCR from symptomatic leaves. TapeStation Systems An Interactive Lab Experience, Chromatography & Spectroscopy Lab Supplies, GC Calculators & Method Translation Software, BioCalculators / Nucleic Acid Calculators. 2023 BioMed Central Ltd unless otherwise stated. Genome sequences of the strains sequenced in this study are available in GenBank BioProject PRJNA631042. Gottwald, T.R, da Graa, J.V, & Bassanezi, R.B. qRT-PCR reactions to identify SARS-CoV-2 positive samples were carried out using a modified version of the Centers for Disease Control and Prevention (CDC) SARS-CoV-2 qRT-PCR assay, as previously described [18]. No we just use an Agilent Bioanalyzer purchased back in 2003. Article The tree with the highest likelihood across 10 runs was selected. The BEI WA1 isolate strain was amplified for both 25 or 35 PCR cycles, using the same enzymes and PCR conditions used for the ARTIC v3 data set. Appl Environ Microbiol. Draft Genome Sequence of Candidatus Liberibacter asiaticus from California. We have the Tape Station for Agilent. Prophage Diversity of Candidatus Liberibacter asiaticus Strains in California. The advantage to negative selection is it allows for the identification of new, large DNA insertions or mutations. The LHCA strain clusters most closely to the other reported California strains, AHCA1 and SGCA5, however it does form its own distinct clade from those strains too. All four LHCA samples are also clustered together. Variants located outside of the region targeted by the amplicon panel were filtered out (reference genome positions 154 and 29,83629,903), and consensus sequences bases corresponding to those regions were trimmed. Phytopathology. We selected 9 SARS-CoV-2 positive patient samples spanning a range of viral loads as assessed by a qRT-PCR using the CDC primers targeting the SARS-CoV-2 nucleocapsid gene (N1 and N2 targets, Supplemental Fig. Performance metrics for Illumina DNA Flex Enrichment Protocol. It is suitable to analyze size, quantity, and integrity of your samples. The PCR products from pool 1 and pool 2 for each sample were combined and then diluted 1:100 in sterile, nuclease-free water, and a second PCR reaction was set up to add the Illumina flow cell adapters and indices. S4). Variants detected for the indicated sample and sequencing protocol at a read depth of up to 1,000,000 raw reads (or the maximum read depth for the sample if below 1,000,000 reads). Used Tapestation for sale. Agilent - Keysight equipment & more - Machinio S2-S3). Gohl DM, Magli A, Garbe J, Becker A, Johnson DM, Anderson S, et al. University of Minnesota Genomics Center, Minneapolis, MN, 55455, USA, Daryl M. Gohl,John Garbe,Patrick Grady,Jerry Daniel,Ray H. B. Watson,Benjamin Auch&Kenneth B. Beckman, Department of Genetics, Cell Biology, and Development, University of Minnesota, Minneapolis, MN, 55455, USA, Department of Lab Medicine and Pathology, Division of Molecular Pathology and Genomics, University of Minnesota, Minneapolis, MN, 55455, USA, You can also search for this author in The need for informed consent was deemed unnecessary by the IRB. D) Agilent Bioanalyzer trace for a library prepared from samples with N1 and N2 Ct values between ~2035 using the tailed amplicon v2 (4 pool amplification) workflow. c The tailed amplicon approach, developed here, enriches first strand cDNA using ARTIC v3 primers containing adapter tails. The integrity of the extracted RNA was analyzed using the Agilent high sensitivity RNA screentape assay on Agilent 2200 TapeStation following the manufacturer's guidelines (Agilent, Santa Clara, CA). Chromatography & Spectroscopy Lab Supplies, GC Calculators & Method Translation Software, BioCalculators / Nucleic Acid Calculators. Devices from other companies that anyone can recommend? The Wuhan-Hu-1 SARS-CoV-2 reference genome (Accession number: MN908947) and the human GRCh38 reference genome primary assembly (Accession number: GCA_000001405.28) used in this study were downloaded from NCBI (https://www.ncbi.nlm.nih.gov/). Chromatography & Spectroscopy Lab Supplies, GC Calculators & Method Translation Software, BioCalculators / Nucleic Acid Calculators. Enriched samples with the lowest pathogen concentration had 99% genome coverage and at least 70X sequence coverage. 3b, Supplemental Fig. Bioinformatics. Depending on the size of your fragments, and the type of sequencing you will do, we choose between three instruments: Creating an Account to Access BRC Services, Cornell Institute of Biotechnology Nat Biotechnol 27, 182189 (2009). 2020;579:2703. Supplemental Table4. It is difficult to draw a comparison between alternative methods since only a few multiplex amplicon-based papers to sequence the whole SARS-CoV-2 genome have . Nat Protoc. Automation of PacBio SMRTbell NGS library preparation for - PubMed PubMed Without enrichment, LHCA-20 and SGCA-20, the highest pathogen concentration samples, had genome coverage of 65 and 60%, respectively, both with 1x depth of coverage (Table1). Amplicon read depths were determined by counting the number of aligned reads covering the base at the center of each amplicon region. The disease has since been identified in multiple states (USDA APHIS Citrus Greening Quarantine map, https://www.aphis.usda.gov/plant_health/plant_pest_info/citrus_greening/downloads/pdf_files/nationalquarantinemap.pdf). SureSelect targeted enrichment, a new cost effective method for the whole genome sequencing of, https://doi.org/10.1038/s41598-019-55144-4. Huanglongbing (HLB) is a worldwide deadly citrus disease caused by the phloem-limited bacteria Candidatus Liberibacter asiaticus (CLas) vectored by Asian citrus psyllids. c Observed read depth for each of the expected amplicons for the BEI WA1 isolate amplified with the ARTIC v3 protocol at a subsampled read depth of 100,000 raw reads. The number in each circle represents the number of SNPs between the different comparisons. We benchmark this approach against both the standard ARTIC v3 protocol and a sequence capture approach using clinical samples spanning a range of viral loads. Quick J, Grubaugh ND, Pullan ST, Claro IM, Smith AD, Gangavarapu K, et al. Supplemental Fig. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data. Here we compare sequence capture and amplicon-based methods for sequencing SARS-CoV-2 and describe a streamlined tailed amplicon method for cost-effective and highly scalable SARS-CoV-2 sequencing. Number of total reads generated per sample using the Illumina Nextera DNA Flex Enrichment workflow relative to: A) Sample N1 Ct value; B) Sample N2 Ct value. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. bioRxiv. We could tell you about the benefits our TapeStation systems have to offerbut we thought showing you would be better! Terms and Conditions, Hundreds of millions of sequencing reads are needed to get good CLas genome coverage from an infected citrus sample, making CLas genome sequencing challenging and costly18. Mass spectrometry, chromatography, spectroscopy, software, dissolution, sample handling and vacuum technologies courses, Live or on-demand webinars on product introductions, applications and software enhancements, Worldwide trade shows, conferences, local seminars and user group meetings, Service Plans, On Demand Repair, Preventive Maintenance, and Service Center Repair, Software to manage instrument access, sample processing, inventories, and more, Instrument/software qualifications, consulting, and data integrity validations, Learn essential lab skills and enhance your workflows, Instrument & equipment deinstallation, transportation, and reinstallation, CrossLab Connect services use laboratory data to improve control and decision-making, Advance lab operations with lab-wide services, asset management, relocation, Shorten the time it takes to start seeing the full value of your instrument investment. Probable Pangolin Origin of SARS-CoV-2 Associated with the COVID-19 Outbreak. Shared and unique variants were compared within and between samples using vcftools diff-site function. Not surprisingly, we got the same prophage pattern for the SGCA strain sequenced in this study as SGCA5 (SC1 only), another strain from the same location14. We performed initial tests of the tailed amplicon v1 protocol by amplifying the samples listed in Fig. The Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, California) is a capillary electrophoresis-based system that can analyse DNA, RNA, and proteins. After all wash steps, the beads were suspended in 50l of nuclease free water. Springer Nature. Agilent Bioanalyzer alternatives? - SEQanswers Characterization of Candidatus Liberibacter asiaticus populations by double-locus analyses. Extracted RNA from de-identified clinical biospecimens were obtained subsequent to COVID-19 testing at the University of Minnesota for use under the IRB approved protocol Detection of COVID 19 by Molecular Methods (STUDY00009560). Cai, W., Yan, Z., Rascoe, J. Reference prophage genome sequences were at the top. Ithaca, NY 14853Email us. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Need Help? Genes | Free Full-Text | Evaluation of the Ion AmpliSeq SARS-CoV-2 Seemann, T. Prokka: rapid prokaryotic genome annotation. We could tell you about the benefits our TapeStation systems have to offerbut we thought showing you would be better! The RNA probe price can drop further to around $100 dollar per sample if it is bulk order (96 reactions each order instead of 16). Input material was not sheared, as the amplicons were already the desired fragment length. Agilent TapeStation Software Displays a - Agilent Technologies https://doi.org/10.1126/science.abc0523. https://doi.org/10.1093/bioinformatics/btp698. Optical and PCR duplicates were flagged in alignment files using Picard v.2.10.5 (http://broadinstitute.github.io/picard). 2020;26. https://doi.org/10.3201/eid2610.201800. PDF Agilent RNA ScreenTape Assay Quick Guide for 4200 TapeStation System There are also smaller, 12-lane E-Gels that can be used for sample recovery. The average coverage at a subsampled read depth of 100,000 raw reads was 99.89% (10x) and 75.90% (100x) for all six test samples (Supplemental Table1, Supplemental Table2). Analytical Validation of a COVID-19 qRT-PCR Detection Assay Using a 384-well Format and Three Extraction Methods. Finally, amplicon approaches (Fig. The most divergent region of the CLas genome is the prophage region, where strains can contain one to three prophages (or, in rare instances, none), with three known prophage types. High quality libraries were identified with an Agilent TapeStation using High Sensitivity D 1000 ScreenTape and then pooled for sequencing. 4200 TapeStation System (Agilent) - We use this instrument as an alternative to the Fragment Analyzer as part of some of our library preparation workflows. After trimming and filtering, 4050% of the enriched reads were discarded due to insufficient read length and suspected probe contamination, while less than 5% of non-enriched reads were discarded (TableS3). Nature. In this study, it costs $500 per sample to obtain the whole genome, which includes $300 RNA probe per reaction and $200 sequencing price. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. FEMTO Pulse System (Agilent) - We use this instrument for high molecular weight (up to 200 kb fragments), very low concentration DNA sizing, or very low concentration RNA quality assessment. All raw read files were deposited to the SRA public database under BioProject ID PRJNA540608. Genome Announc, https://doi.org/10.1128/genomeA.00170-17 (2017). Reverse indexing primer: CAAGCAGAAGACGGCATACGAGATXXXXXXXXXXGTCTCGTGGGCTCGG. Grubaugh ND, Gangavarapu K, Quick J, Matteson NL, De Jesus JG, Main BJ, et al. Sequencing-based genomic surveillance has been applied to both endemic disease, such as seasonal influenza [1], and to emerging disease outbreaks such as Zika and Ebola [2,3,4]. 4200 TapeStation manual>Check Correct Insertion of Lower Nest Cover (page 165) and animation in Agilent Information Center (AIC) (Start Menu>Agilent TapeStation Software>AIC) 2200 TapeStation. Michael J. Stulberg. The tailed amplicon method we describe represents a cost-effective and highly scalable method for SARS-CoV-2 sequencing. Will Agilent (A) Beat Estimates Again in Its Next Earnings Report? Select Tape Type D5000 ScreenTape assays is comparable to Bioanalyzer High Sensitivity DNA Chip Full tape and per sample options are available for the High Sensitivity D5000 and Genomic DNA tapes. SNPs were determined using Samtools v1.7. We also provide accurate quantification and sizing of NGS library. Each LHCA sample contained prophages SC1 and SC2, while SGCA samples contained only SC1 (Fig. It is suitable to analyze size, quantity, and integrity of your samples. Google Scholar. 2a-b, Supplemental Tables12). G) 2% agarose gel showing the presence of primer dimers particularly in high N1/N2 Ct samples when indexed using different PCR cycling conditions. I don't remember off the top of my head, the big brother version was significantly more expensive than the BioA/Tapestation. Identification of a polymorphism in the N gene of SARS-CoV-2 that adversely impacts detection by a widely-used RT-PCR assay. Samples were processed as described above for the two-pool tailed amplicon sequencing workflow, with the exception that in the first round of PCR, four separate reactions were set up using primer pools 1.1, 1.2, 2.1, and 2.2 (see Supplemental Data File2 for primer sequences and pool composition) using 2.5L of template cDNA per reaction. Cite this article. We tested a tailed amplicon method (tailed amplicon v1) in which the tailed version of the ARTIC v3 primers were pooled into two pools in a similar manner to the ARTIC v3 protocol. 43(3), e15e15 (2014). (Lonza's FlashGel is a similar system.) Bioinformatics. Hundreds of millions of sequencing reads are needed to get good coverage of CLas from an HLB positive citrus sample. Variants detected using different sequencing workflows. J Plant Pathol 88, 373714 (2006). Gohl DM, Vangay P, Garbe J, MacLean A, Hauge A, Becker A, et al. More posts you may like r/labrats Join 9 days ago Lab archetypes 512 131 r/labrats Join 28 days ago The following indexing primers were used (X indicates the positions of the 10bp unique dual indices): Forward indexing primer: AATGATACGGCGACCACCGAGATCTACACXXXXXXXXXXTCGTCGGCAGCGTC. The coefficient of variation (CV) of the ARTIC v3 sample was 0.49 and the CVs of the tailed amplicon v1 samples were 1.70 and 1.26 for the 25 and 35 PCR cycle samples, respectively. Alignment files were filtered to remove PCR duplicates, retaining only reads in proper pairs with robust mapping quality (MAPQ10) using Samtools v. 1.728. I use the Qiaxcel system. The ARTIC network (https://artic.network/) has established a method for preparing amplicon pools in order to sequence SARS-CoV-2 (Fig. Free software from Agilent is available to view your data on a PC. The positions of all variants detected in this study are shown and bases where the sample matches the Wuhan-Hu-1 reference shown in grey. Plant Health Progr, https://doi.org/10.1094/PHP-2007-0906-01-RV (2007). The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. Croucher, N. J. et al. PubMedGoogle Scholar. We describe a modified workflow for SARS-CoV-2 sequencing which builds on the tiled amplicon approach developed by the ARTIC consortium and currently employed by many labs around the world. Base calling and sample de-multiplexing were generated as paired FASTQ files for each sample. The alignment is generated using bowtie2 plugged in Geneious v 10.2.4, and visualized in Integrated Genome Viewer v2.4.10. Genome Res. 3c, Supplemental Fig. Article Supplemental Fig. The Agilent system takes 30 minutes to analyse 12 samples per run whereas each ScreenTape for the tapestation can analyze 16 samples (1 sample for the library and 15 samples per tape). Metagenomic (RNA) sequencing can be used to sequence and assemble the SARS-CoV-2 genome [10]. To generate cDNA upstream of SARS-CoV-2 genome amplification, the following reaction was set up: 5L template RNA, 11L nuclease-free water, 4L SuperScript IV VILO master mix (Thermo Fisher Scientific, Waltham, MA). This led to decreased coverage at a given read depth for the tailed amplicon v1 method relative to ARTIC v3 (Fig. Less than 45% of SNPs in LHCA were identified in SGCA samples, suggesting this enrichment method does not change the pan-genome variability. 2016;34:9429. The TapeStation System proved to be a reliable . Hashino M, Tanaka R, Kuroda M. A proposal of alternative primers for the ARTIC Network's multiplex PCR to improve coverage of SARS-CoV . A pan-genome comparative approach could provide enough genetic variation for high strain resolution, but sequencing CLas genomes has been historically difficult. Bioinformatics. 2019;37:1608. A new coronavirus associated with human respiratory disease in China. Profiles of CLas MiSeq reads mapping in reference to prophage SCI, SC2 and JXGC-3. The system integrates an instrument, data processing software, reagents, and ScreenTape devices specific for DNA and RNA. https://doi.org/10.1038/s41579-020-0354-7. For the most recent quarter, Agilent was expected to post earnings of $1.31 per share, but it reported $1.37 per share instead, representing a surprise of 4.58%. The poorer performance with respect to coverage metrics with the tailed amplicon v1 protocol was due to substantially worse balance between the different tiled amplicons compared with the ARTIC v3 (untailed) primers (Fig. The second strand synthesis reaction was incubated at 16C for 60min. 2010. http://www.bioinformatics.babraham.ac.uk/projects/fastqc/. Di Paola N, Sanchez-Lockhart M, Zeng X, Kuhn JH, Palacios G. Viral genomics in Ebola virus research. Twenty-five l of the DNA libraries, bound to streptavidin beads, was amplified by PCR using SureSelect post capture primer mix and Herculase II Fusing DNA polymerase. Itokawa K, Sekizuka T, Hashino M, Tanaka R, Kuroda M. A proposal of alternative primers for the ARTIC Network's multiplex PCR to improve coverage of SARS-CoV-2 genome sequencing. Tailed amplicon v1 pool primer sequences. 31(22), 36913693 (2015). contributed experimental samples and helped write the manuscript. Library preparation was performed following the standard Illumina TruSeq Nano DNA protocol for 350 base pair libraries (Illumina, San Diego, CA). Mass spectrometry, chromatography, spectroscopy, software, dissolution, sample handling and vacuum technologies courses, Live or on-demand webinars on product introductions, applications and software enhancements, Worldwide trade shows, conferences, local seminars and user group meetings, Service Plans, On Demand Repair, Preventive Maintenance, and Service Center Repair, Software to manage instrument access, sample processing, inventories, and more, Instrument/software qualifications, consulting, and data integrity validations, Learn essential lab skills and enhance your workflows, Instrument & equipment deinstallation, transportation, and reinstallation, CrossLab Connect services use laboratory data to improve control and decision-making, Advance lab operations with lab-wide services, asset management, relocation, Shorten the time it takes to start seeing the full value of your instrument investment. Five patient samples with N1 and N2 Ct values ranging from ~2035 and the BEI WA isolate sample were selected for TruSeq library prep and sequencing; one sample (N1 Ct=20, N2 Ct=20.4) was prepared in triplicate. A-F) Observed read depth for each of the expected amplicons for the indicated sample amplified with the tailed amplicon v2 protocol at a subsampled read depth of 100,000 raw reads. The tailed amplicon v1 method produced lower coverage than the ARTIC v3 method, with 98.87% coverage at a minimum of 10x and 89.40% coverage at a minimum of 100x for the 25 PCR cycle sample and 97.09% coverage at a minimum of 10x and 81.31% coverage at a minimum of 100x for the 35 PCR cycle sample (Fig. The approach we describe is similar to a tailed-amplicon method that we have used to process more than 150,000 microbiome samples in recent years in the University of Minnesota Genomics Center [14], and thus represents a highly scalable method for sequencing large numbers of SARS-CoV-2 genomes in a rapid and cost-effective manner. Ct values were exported and analyzed in Microsoft Excel. All other genomes were obtained from NCBI. SNPs were determined based on the alignment profile to Psy62. General. However, NGS technology has significant limitations when performing pathogen diagnostics in complex metagenomic samples. Slider with three articles shown per slide. 3b, Supplemental Fig. Liberibacter asiaticus (CLas) is the most widespread and is the only species associated with the disease in the United States (U.S.)4. Int J Syst Evol Microbiol. While adjusting the primer concentration for over-represented amplicons did lower the CV of the tailed amplicon pool, amplicon balance was still substantially worse than with the untailed ARTIC v3 primers (data not shown). The following recipe was used to set up the PCR reactions: 2.5L template cDNA, 14.75L nuclease-free water, 5l 5x Q5 reaction buffer (New England Biolabs, Ipswich, MA), 0.5L 10mM dNTPs (Kapa Biosystems, Woburn, MA), 0.25L Q5 Polymerase (New England Biolabs, Ipswich, MA), 2L primer pool 1 or 2 (10M). e Tailed amplicon v1 (2 pool amplification); f Tailed amplicon v2 (4 pool amplification). Zheng, Z., Deng, X., & Chen, J. The resulting tree was midpoint rooted and visualized using FigTree v1.4.3 (http://tree.bio.ed.ac.uk/software/figtree/). Size distribution of each barcoded cDNA library determined on the Agilent TapeStation 2200 using the Agilent High Sensitivity D1000 ScreenTape Assay in the nasopharyngeal swab . Bioanalyzer 2100 or Tapestation 4150? | ResearchGate The Agilent TapeStation system is an automated electrophoresis solution for the sample quality control of DNA and RNA samples. 2020:eabc0523. Effective disease managing efforts require a greater understanding of the causal agents, which can be achieved through whole genome sequencing. It does use gel capillaries and the array lasts for only 6 months at a time so if you are not a high volume user, it might not be as cost effective as it is for me. A total of 100ng of amplicons from the ARTIC protocol were used as the input for library preparation. Samples for initial SARS-CoV-2 sequencing workflow tests. Page, A. J. et al. Consistent with previous descriptions of the ARTIC v3 primers, the balance between the tiled amplicons across these samples was relatively even, with a mean CV of 0.61 among the five patient samples tested, and 0.55 for samples with a N1 and N2 Ct of less than 30 (Fig. Next generation sequencing technologies (NGS) have recently enabled large-scale genomic surveillance of infectious diseases. Supplemental Table2. In this article, we focus on metrics relevant to evaluating the success of a Pacific Biosciences (PacBio) sequencing run. The overlapping number stands for the same SNPs identified between the different comparisons and the non-overlapping numbers specify the unique SNPs to each sample. Supplemental Fig. Mamanova, L. et al. https://doi.org/10.1038/nbt.3601. 2015;523:21720. S1. Check out the interactive hotspots below and see what these instruments can do for your lab. Bankevich, A. et al. 3a for 25 or 35 PCR cycles using tailed versions of the ARTIC v3 primers split into two separate pools. Sequence capture methods (Fig. Rapid phylogenetic analysis of large samples of recombinant bacterial whole genome sequences using Gubbins. S1). I came from a lab in industry that trialed the BioA, TapeStation, Caliper system and Advanced Analytical fragment analyzer. Thus a targeted genome enrichment method may be useful and necessary. This pattern was consistent across different concentrations of the same strain. Filtered high quality reads were mapped to the HLB Psy62 strain reference genome (GenBank accession number GCA_000023765.2) using bowtie2 v2.3.3 in sensitive mode23. conducted the experiments and helped write the manuscript; A.N. Deng, X. et al. It is suitable to analyze size, quantity, and integrity of your samples. Reactions were run on a QuantStudio QS5 (Thermo Fisher Scientific, Waltham, MA) using the following cycling conditions: one cycle of 45C for 15min, followed by one cycle of 95C for 2min, followed by 45cycles of 95C for 15s and 60C for 1min. bioanalyzeR - Stanford University Click here to register now, and join the discussion. 1). While other groups in the company chose the BioA for the sake of "it's the standard," we chose the Advanced Analytical as it outperformed in almost every way, including running fragment analysis of dirty digests, without getting clogged. The iVar software package was used to trim primer sequences from the aligned reads, and iVar and Samtools mpileup were used to call variants and generate consensus sequences [3].

Green Lion Stamp On Eggs, Rise Of Kingdoms Attacking Center Fortress, Emily Anderson Bbc East Midlands, Buzz Silverman Net Worth, Irish Sea Conditions Liverpool To Belfast, Articles A